X Tr Tr Simulation online.docx View only Transcription/Translation Simulation 58140 Name: Date: Use your DNA strand belo

[answerhappygod]

X Tr Tr Simulation Online Docx View Only Transcription Translation Simulation 58140 Name Date Use Your Dna Strand Belo 1 (29.43 KiB) Viewed 117 times

X Tr Tr Simulation online.docx View only Transcription/Translation Simulation 58140 Name: Date: Use your DNA strand below to complete transcription and translation. Use point form and your own words! 1. a) which strand of DNA will you use? b) what do you notice about the region near the beginning of this strand? 2. Transcribe your DNA to get the resulting mRNA directio coding strand 3 TAATTGCCTTATATATGTTAGACGTAGGGTGAGGATCC 5 template strand 5 ATTAACGGAATATATACAATCTGCATCCCACTCCTAGG 3 mRNA 5 in amino acids N o с 3. Underline the start codon on the mRNA 4. How does the mRNA compare to each strand? 5. Translate the mRNA into an amino acid sequence using the genetic code in your textbook 6. What other, more complex things would happen a) post transcription? b) post translation?