X Tr Tr Simulation online.docx View only Transcription/Translation Simulation 58140 Name: Date: Use your DNA strand belo

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899604
Joined: Mon Aug 02, 2021 8:13 am

X Tr Tr Simulation online.docx View only Transcription/Translation Simulation 58140 Name: Date: Use your DNA strand belo

Post by answerhappygod »

X Tr Tr Simulation Online Docx View Only Transcription Translation Simulation 58140 Name Date Use Your Dna Strand Belo 1
X Tr Tr Simulation Online Docx View Only Transcription Translation Simulation 58140 Name Date Use Your Dna Strand Belo 1 (29.43 KiB) Viewed 116 times
X Tr Tr Simulation online.docx View only Transcription/Translation Simulation 58140 Name: Date: Use your DNA strand below to complete transcription and translation. Use point form and your own words! 1. a) which strand of DNA will you use? b) what do you notice about the region near the beginning of this strand? 2. Transcribe your DNA to get the resulting mRNA directio coding strand 3 TAATTGCCTTATATATGTTAGACGTAGGGTGAGGATCC 5 template strand 5 ATTAACGGAATATATACAATCTGCATCCCACTCCTAGG 3 mRNA 5 in amino acids N o с 3. Underline the start codon on the mRNA 4. How does the mRNA compare to each strand? 5. Translate the mRNA into an amino acid sequence using the genetic code in your textbook 6. What other, more complex things would happen a) post transcription? b) post translation?
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Post Reply