Note this is Nor a file submiasien questien. Pieate type your answers in the provided spaces. highilighted in yeliou. 1

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899604
Joined: Mon Aug 02, 2021 8:13 am

Note this is Nor a file submiasien questien. Pieate type your answers in the provided spaces. highilighted in yeliou. 1

Post by answerhappygod »

Note This Is Nor A File Submiasien Questien Pieate Type Your Answers In The Provided Spaces Highilighted In Yeliou 1 1
Note This Is Nor A File Submiasien Questien Pieate Type Your Answers In The Provided Spaces Highilighted In Yeliou 1 1 (24.74 KiB) Viewed 36 times
Note this is Nor a file submiasien questien. Pieate type your answers in the provided spaces. highilighted in yeliou. 1 tranf are shown in reed. The cleavage site is in gretr. 5 - ICCATAT CCOTATGCGCCCTAGE CTTGTAGATGAGACCTGGCATGC - J: 3. AGGTATMGGCATACGCCGSATCG GAACATCT ACTCTGGACCGTACG - 5 Instructions: a) (4 pts) Copy B. paste the DNA sequence into the answer box, then label the template and coding DNA strands and highight the and regions- Make it clear what you are labeing (use different colors) and hightight the whole sequence. not just the first base-pair- b) (2 pts) Transcribe the gene, showing the initial pre-mRNA that has not undergone any editing. Make sure you start and end transcription in the right placef c) (4 pt5) Now draw the mature mRNA that has been processed and is ready to leave the nucleus. Clearly label 3 ' and 5 ends.
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Top
Post Reply

Return to “Archived Questions & Answers”