java Our goal is to take a strand of DNA and find what protein it specifies. (This is a simplified version of actual pro

[answerhappygod]

java
Our goal is to take a strand of DNA and find what protein itspecifies. (This is a simplified version of actual proteintranslation.)
DNA consists of two strands of nucleotide bases (A, C, T, and G)twisted in a double helix, and portions of DNA encode the structureof proteins to be built. To build a protein, the two strands of DNAare separated, one is used to create an RNA strand, and that RNAstrand is used to create a string of amino acids, which the proteinis composed of.
To convert DNA to the proteins it encodes, there are twosteps:
Transcription
DNA is composed of 4 nucleotide bases: adenine (A), cytosine(C), guanine (G), and thymine (T). RNA is also composed of 4 bases:adenine (A), cytosine (C), guanine (G), and uracil (U). To converta strand of DNA to RNA, we use the following mapping:
Translation
Once a strand of DNA has been converted to RNA, we can convertthat to a protein.
A protein is a sequence of amino acids. A "codon" is a sequenceof 3 RNA bases. The RNA strand is scanned left to right to find a"start codon" of AUG. Then subsequent codons are converted to aminoacids according to the table below, until a "stop codon" isreached. There are three stop codons: UAA, UGA, and UAG. Note thatin our model, all proteins must start with methionine, since thisis what AUG encodes.
A star (*) in the table indicates any RNA base. For example,alanine is encoded by any of GCA, GCC, GCG, or GCU.
Example
Given the DNA string ACTACACGACAGTAACTACGA, we first convert itto RNA to get UGAUGUGCUGUCAUUGAUGCU.
Then we look for the start codon AUG, which appears at index 2(so the first two RNA bases will be ignored).
Now we can break the string into codons: UG AUG UGC UGU CAU UGAUGC U.
AUG maps to methionine (Met), both UGC and UGU map to cysteine(Cys), CAU maps to histidine (His), and then UGA is a stop codon(so anything after UGA will be ignored).
Therefore, this strand encodes the protein with the amino acidsequence Met Cys Cys His.
IN JAVA without scanner.