- Problem Set Ii Nucleic Acids Replication Transcription And Translation Problem 1 10 Points Human And Bacteria Differ 1 (75.06 KiB) Viewed 35 times
Problem Set II Nucleic Acids: Replication, Transcription and Translation Problem 1. 10 points. Human and bacteria differ
-
- Site Admin
- Posts: 899603
- Joined: Mon Aug 02, 2021 8:13 am
Problem Set II Nucleic Acids: Replication, Transcription and Translation Problem 1. 10 points. Human and bacteria differ
Problem Set II Nucleic Acids: Replication, Transcription and Translation Problem 1. 10 points. Human and bacteria differ in the organization of genetic information. A series of eukaryotic gene sequences (coding sequences) is given below. Based on this portion of the gene sequence, which gene could produce a protein that contains 300 amino acids and has a phenylalanine residue near its N-terminus? EXPLAIN WHY YOU CHOSE YOUR ANSWER AND EXEMPTED THE OTHER 4 ANSWERS. A. 5'-...CCACGCCATTTGCATCA...-3' B. 5'-...CCTAGCCATTTGCATGA...-3' C. 5'-...CCATGCCATTTTGCATC...-3' D. 5'-...CCATCCCATTTGCATCA...-3' E. 5'-...CCATCCCATTTGCATGA...-3' Problem 2. 7 points. Translate the mRNA open reading frame below. Write the amino acid primary sequence beginning with the START and ending with the STOP. ORF ↑ Start codon NIO Stop codon 5' GUGGCCAGGAGGUCGGGAUGUAUAAUACCAGGCAUGCGGAGCUCUGUGCCAAAUAA