Problem Set II Nucleic Acids: Replication, Transcription and Translation Problem 1. 10 points. Human and bacteria differ

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899603
Joined: Mon Aug 02, 2021 8:13 am

Problem Set II Nucleic Acids: Replication, Transcription and Translation Problem 1. 10 points. Human and bacteria differ

Post by answerhappygod »

Problem Set Ii Nucleic Acids Replication Transcription And Translation Problem 1 10 Points Human And Bacteria Differ 1
Problem Set Ii Nucleic Acids Replication Transcription And Translation Problem 1 10 Points Human And Bacteria Differ 1 (75.06 KiB) Viewed 35 times
Problem Set II Nucleic Acids: Replication, Transcription and Translation Problem 1. 10 points. Human and bacteria differ in the organization of genetic information. A series of eukaryotic gene sequences (coding sequences) is given below. Based on this portion of the gene sequence, which gene could produce a protein that contains 300 amino acids and has a phenylalanine residue near its N-terminus? EXPLAIN WHY YOU CHOSE YOUR ANSWER AND EXEMPTED THE OTHER 4 ANSWERS. A. 5'-...CCACGCCATTTGCATCA...-3' B. 5'-...CCTAGCCATTTGCATGA...-3' C. 5'-...CCATGCCATTTTGCATC...-3' D. 5'-...CCATCCCATTTGCATCA...-3' E. 5'-...CCATCCCATTTGCATGA...-3' Problem 2. 7 points. Translate the mRNA open reading frame below. Write the amino acid primary sequence beginning with the START and ending with the STOP. ORF ↑ Start codon NIO Stop codon 5' GUGGCCAGGAGGUCGGGAUGUAUAAUACCAGGCAUGCGGAGCUCUGUGCCAAAUAA
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Post Reply