As a student in a lab, you are provided DNA with the sequence that is shown below. Your mentor asks that you design DNA
Posted: Tue Jul 05, 2022 7:43 am
- As A Student In A Lab You Are Provided Dna With The Sequence That Is Shown Below Your Mentor Asks That You Design Dna 1 (174.53 KiB) Viewed 12 times
As a student in a lab, you are provided DNA with the sequence that is shown below. Your mentor asks that you design DNA primers to amplify the bold and underlined. region of the DNA by PCR. Provide a 20 nucleotide sequence of the primers that you would design and indicate the 5' and 3' ends of each primer. TCAGTTTAGCGCGCTGATCTGAGTCGAGATAAAATCACCAGTACCCAAGACCAGGGGGGCTCGCCACG TTGGCTAATCCTGGTACATCTTGTAATCAATATTCAGTAGAAAATTTGTGTTAGAAGGACGAGTCACCA TGTACCAATAGCGATAACGATCGGTCGGACTATTCATTGTGGTGATGACGCTGGGTTTACGTGGGAAA GGTGCTTGTGTCCCGACA GGCTAGGATATAATGCTGAGGCCCTTC