As a student in a lab, you are provided DNA with the sequence that is shown below. Your mentor asks that you design DNA

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899603
Joined: Mon Aug 02, 2021 8:13 am

As a student in a lab, you are provided DNA with the sequence that is shown below. Your mentor asks that you design DNA

Post by answerhappygod »

As A Student In A Lab You Are Provided Dna With The Sequence That Is Shown Below Your Mentor Asks That You Design Dna 1
As A Student In A Lab You Are Provided Dna With The Sequence That Is Shown Below Your Mentor Asks That You Design Dna 1 (174.53 KiB) Viewed 10 times
explain plz
As a student in a lab, you are provided DNA with the sequence that is shown below. Your mentor asks that you design DNA primers to amplify the bold and underlined. region of the DNA by PCR. Provide a 20 nucleotide sequence of the primers that you would design and indicate the 5' and 3' ends of each primer. TCAGTTTAGCGCGCTGATCTGAGTCGAGATAAAATCACCAGTACCCAAGACCAGGGGGGCTCGCCACG TTGGCTAATCCTGGTACATCTTGTAATCAATATTCAGTAGAAAATTTGTGTTAGAAGGACGAGTCACCA TGTACCAATAGCGATAACGATCGGTCGGACTATTCATTGTGGTGATGACGCTGGGTTTACGTGGGAAA GGTGCTTGTGTCCCGACA GGCTAGGATATAATGCTGAGGCCCTTC
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Post Reply