Page 1 of 1
+ Line 1 2 3 st 5 50 7 8 4) Read the DNA sequence given below in the 3 to 5' direction and circle all of the potential s
Posted: Tue Jul 05, 2022 7:42 am
by answerhappygod
- Line 1 2 3 St 5 50 7 8 4 Read The Dna Sequence Given Below In The 3 To 5 Direction And Circle All Of The Potential S 1 (107.26 KiB) Viewed 11 times
+ Line 1 2 3 st 5 50 7 8 4) Read the DNA sequence given below in the 3 to 5' direction and circle all of the potential start codons (i.e. every time you see the DNA version of a start codon, even if it does not immediately come after a promoter). How many potential start codons did you find? 3-TICCGTAACTICGGCGCATCTAGCTIGAGCTCCAATCAGG ACTACTIATAAAAAICTICTCGAGAGAGCTIIACTCCTACTC TCTTAGTCGATICCATCGGACCTACGATIGACAAG C G C G GT C TACTATCTACTIATIIATILACGAGCGTIGATICTACCTACTG ACGACTAGGGCATICTATAGGATIAACTCCTIATIIIAA СТА ACTICCTGGGAAGGCGCCTITATCTGATCCGTAATCCGTCCG AAGGCTCTGATCGGATIACTGGGTCACTGGAAAGTGACCGCT GTCTATTACTGTATLICATCT GATIGACTATILLATAGTCG-5¹ 5) Now find and circle the promoter region 3'-TATAAAA -5' in the sequence above.