+ Line 1 2 3 st 5 50 7 8 4) Read the DNA sequence given below in the 3 to 5' direction and circle all of the potential s

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899603
Joined: Mon Aug 02, 2021 8:13 am

+ Line 1 2 3 st 5 50 7 8 4) Read the DNA sequence given below in the 3 to 5' direction and circle all of the potential s

Post by answerhappygod »

Line 1 2 3 St 5 50 7 8 4 Read The Dna Sequence Given Below In The 3 To 5 Direction And Circle All Of The Potential S 1
Line 1 2 3 St 5 50 7 8 4 Read The Dna Sequence Given Below In The 3 To 5 Direction And Circle All Of The Potential S 1 (107.26 KiB) Viewed 9 times
+ Line 1 2 3 st 5 50 7 8 4) Read the DNA sequence given below in the 3 to 5' direction and circle all of the potential start codons (i.e. every time you see the DNA version of a start codon, even if it does not immediately come after a promoter). How many potential start codons did you find? 3-TICCGTAACTICGGCGCATCTAGCTIGAGCTCCAATCAGG ACTACTIATAAAAAICTICTCGAGAGAGCTIIACTCCTACTC TCTTAGTCGATICCATCGGACCTACGATIGACAAG C G C G GT C TACTATCTACTIATIIATILACGAGCGTIGATICTACCTACTG ACGACTAGGGCATICTATAGGATIAACTCCTIATIIIAA СТА ACTICCTGGGAAGGCGCCTITATCTGATCCGTAATCCGTCCG AAGGCTCTGATCGGATIACTGGGTCACTGGAAAGTGACCGCT GTCTATTACTGTATLICATCT GATIGACTATILLATAGTCG-5¹ 5) Now find and circle the promoter region 3'-TATAAAA -5' in the sequence above.
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Top
Post Reply

Return to “Archived Questions & Answers”