Transcribe & translate these bacterial ORFs (open reading frame) from DNA sequence into mRNA / polypeptide. These are th

[answerhappygod]

Transcribe Translate These Bacterial Orfs Open Reading Frame From Dna Sequence Into Mrna Polypeptide These Are Th 1 (33.4 KiB) Viewed 10 times

Transcribe & translate these bacterial ORFs (open reading frame) from DNA sequence into mRNA / polypeptide. These are the non-template strands. 5' TCAATGGAACGCGCTACCCGGAGCTCTGGGCCCARATTTCATTGACACT 3 5* GGGATCGATGOCCOTTAAAGAGTTTACATAT Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to contain a very small gene. Transcription starts at the Transcription Start Site (TSS) after the promoter (shown in yellow), and proceeds in the direction of the arrow Transcription stops at the end of the Transcription Terminator (shown in blue). TSS St-CEATAANGAGCCATOCATTATOTAGATAGTAGGOTO 31-6A1 14.04 OTACOTAATAGATCTATCATCE terminator CGGA 3' promoter a) Which strand of DNA shown, the top or the bottom, is the template strand? b) What is the sequence of the mRNA produced from this gene? Label the 5 and 3* ends. c) What is the sequence of the protein produced from the mRNA in (b)? Label the N and C termini. Translate the primary structure of this mRNA. 5 GGAUGCAGGGUAGCGCGUUACAUUGAAAAUAU 3