You may change your response by submitting again. You observe three regions that are conserved between the mouse, rat, a

[answerhappygod]

You May Change Your Response By Submitting Again You Observe Three Regions That Are Conserved Between The Mouse Rat A 1 (299.5 KiB) Viewed 13 times

You may change your response by submitting again. You observe three regions that are conserved between the mouse, rat, and human orthologs of this gene. (Ortholog is the term for a gene that is structurally and functionally conserved between related organisms). From this observation, you hypothesize that this region of regulatory DNA binds three specific regulatory transcription factors-one at each conserved region. Region 1 Region 2 Region 3 Mouse: CGATAATGCCAAATTOGTAATTCAACAAGCAAGTAGGAATT Rat: ACATAATGCCAGCAGAGTAATTGTTGCAGCAAGTAGGGCAG Human: CTATAATGCCACTCCTGTAATTAGATAAGGAAGTAGGTCTC To test the hypothesis that the three conserved regions function as regulatory DNA, you make several transgenic constructs using a GFP reporter gene and you evaluate their expression in developing heart and lung tissue. Construct 1 is the wild-type construct. Notice that this constuct has normal expression in both tissues. For Constructs 2-8, you introduced point mutations into each of the three conserved regions (indicated by ***). Expression results for each of these constructs are indicated in the chart. Construct Construct 2 Construct Construct 4 Construct 5 Construct Construct 7 Construct Lager 1 3 2 1 1 3 1 3 Smaller None 123 - Lane 1 Lane 2 Lane 3 Lane 4 Region 1 Region 2 Region 3 You further investigate the regulatory proteins that bind to Regions 1, 2 and 3 using gel shift assays. A gel shift assay uses labeled DNA as a target for regulatory protein binding. A labeled DNA fragment that fails to bind a protein will migrate quickly on an electrophoretic gel A labeled DNA fragment that does bind a protein will migrate more slowly because the DNA + protein complex is larger than the DNA alone. Thus, the label associated with the DNA will "shift" to a higher location on the gel, as shown in this diagram. -) Lane 5 Lane 6 Lane 7 Lane 8 Resubmit **** *** Lane: ONA To investigate regulatory protein binding to regions 1, 2, and 3, you use labeled DNA fragments with all regions intact (123), and various fragments with the same point mutations as in Part B. Fragments with a mutated region are indicated with an "X." (For example, a fragment with intact Region 1, mutated Region 2, and intact Region 3 is noted as (1 X 3) in the diagram below.) You incubate each fragment with protein extracted from heart (H) or lung (L) tissue and compare it to DNA alone (None). You observe bands of differing sizes for the wild-type (123) fragment. Predict the gel shift assay results for each mutated fragment by choosing the correct banding pattern for each location (A, B, C or D). 8888 GFP ▬▬▬▬ unbound X 23 1 2 GFP in heart tissue Resubmit and Next present absent present absent absent absent absent ✔: Mark this question for later review. GFP in lung tissue present present absent present absent present absent 12X 5 X 2 X 1) Banding pattem A (None) 2) Banding pattern B (Heart) 3) Banding pattern C (Lung) 4) Banding pattern D (intermediate)