Page 1 of 1
A promoter re- gion can be blocked by an- other protein. Histone deacetylation can pre- vent DNA from unwinding. Alterna
Posted: Thu Jun 30, 2022 6:36 pm
by answerhappygod
- A Promoter Re Gion Can Be Blocked By An Other Protein Histone Deacetylation Can Pre Vent Dna From Unwinding Alterna 1 (47.73 KiB) Viewed 29 times
A promoter re- gion can be blocked by an- other protein. Histone deacetylation can pre- vent DNA from unwinding. Alternative splicing within the gene Start sequence can lead to different forms wedd gene ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA ▬▬▬▬▬▬▬▬▬▬▬▬▬ Stop TACTGCCTAGTO CGTTCGCCTTAACCGCTGTATT A possible location for a regulatory region that can be bound and increase transcription rates.