- A Promoter Re Gion Can Be Blocked By An Other Protein Histone Deacetylation Can Pre Vent Dna From Unwinding Alterna 1 (47.73 KiB) Viewed 28 times
A promoter re- gion can be blocked by an- other protein. Histone deacetylation can pre- vent DNA from unwinding. Alterna
-
- Site Admin
- Posts: 899603
- Joined: Mon Aug 02, 2021 8:13 am
A promoter re- gion can be blocked by an- other protein. Histone deacetylation can pre- vent DNA from unwinding. Alterna
A promoter re- gion can be blocked by an- other protein. Histone deacetylation can pre- vent DNA from unwinding. Alternative splicing within the gene Start sequence can lead to different forms wedd gene ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA ▬▬▬▬▬▬▬▬▬▬▬▬▬ Stop TACTGCCTAGTO CGTTCGCCTTAACCGCTGTATT A possible location for a regulatory region that can be bound and increase transcription rates.