Page 1 of 1
Imagine you want to PCR amplify a 40-50 base pair fragment from the following DNA sequence: 5'-GTACCTGAGCTAGGCTCAGAAGTCG
Posted: Thu Jun 30, 2022 6:35 pm
by answerhappygod
- Imagine You Want To Pcr Amplify A 40 50 Base Pair Fragment From The Following Dna Sequence 5 Gtacctgagctaggctcagaagtcg 1 (113.81 KiB) Viewed 74 times
Imagine you want to PCR amplify a 40-50 base pair fragment from the following DNA sequence: 5'-GTACCTGAGCTAGGCTCAGAAGTCGTTCAGTCTTGCCCGATTAGCTTGGGCGATATGCGCGTAGCCTAG-3' 3'-CATGGACTCGATCCGAGTCTTCAGCAAGTCAGAACGGGCTAATCGAACCCGCTATACGCGCATCGGATC-5' You decide to use the following as one of your primers: 5'-TGAGCTAGGCTCAGAAGTCGT-3' Which of the following would be a good choice of a 2nd primer to use in combination with your chosen primer? Note: these are all written in the 5' to 3' direction. Group of answer choices CATATCGCCCAAGCTAATCG TTAGCTTGGGCGATATGCG ACTTAGACTGGACTCTGAGT TTGCAATGTCAGGACTACGC