Imagine you want to PCR amplify a 40-50 base pair fragment from the following DNA sequence: 5'-GTACCTGAGCTAGGCTCAGAAGTCG

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899603
Joined: Mon Aug 02, 2021 8:13 am

Imagine you want to PCR amplify a 40-50 base pair fragment from the following DNA sequence: 5'-GTACCTGAGCTAGGCTCAGAAGTCG

Post by answerhappygod »

Imagine You Want To Pcr Amplify A 40 50 Base Pair Fragment From The Following Dna Sequence 5 Gtacctgagctaggctcagaagtcg 1
Imagine You Want To Pcr Amplify A 40 50 Base Pair Fragment From The Following Dna Sequence 5 Gtacctgagctaggctcagaagtcg 1 (113.81 KiB) Viewed 72 times
Imagine you want to PCR amplify a 40-50 base pair fragment from the following DNA sequence: 5'-GTACCTGAGCTAGGCTCAGAAGTCGTTCAGTCTTGCCCGATTAGCTTGGGCGATATGCGCGTAGCCTAG-3' 3'-CATGGACTCGATCCGAGTCTTCAGCAAGTCAGAACGGGCTAATCGAACCCGCTATACGCGCATCGGATC-5' You decide to use the following as one of your primers: 5'-TGAGCTAGGCTCAGAAGTCGT-3' Which of the following would be a good choice of a 2nd primer to use in combination with your chosen primer? Note: these are all written in the 5' to 3' direction. Group of answer choices CATATCGCCCAAGCTAATCG TTAGCTTGGGCGATATGCG ACTTAGACTGGACTCTGAGT TTGCAATGTCAGGACTACGC
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Post Reply