- 10 If You Are Presented With The Following Dna Coding Sequence 0 8 Pts Tgtattaaaatggcatttttagacagtagaaccttttctggggag 1 (50.42 KiB) Viewed 159 times
10. If you are presented with the following DNA coding sequence: (0.8 pts) TGTATTAAAATGGCATTTTTAGACAGTAGAACCTTTTCTGGGGAG
-
answerhappygod
- Site Admin
- Posts: 899604
- Joined: Mon Aug 02, 2021 8:13 am
10. If you are presented with the following DNA coding sequence: (0.8 pts) TGTATTAAAATGGCATTTTTAGACAGTAGAACCTTTTCTGGGGAG
10. If you are presented with the following DNA coding sequence: (0.8 pts) TGTATTAAAATGGCATTTTTAGACAGTAGAACCTTTTCTGGGGAGTGGG ACAGAACTGATATTTTCGCAAAATTTATTTCGCTATAATTTCTTTT a. Label the 3' and 5' ends. b. There are two open reading frames (orfs) in this strand of DNA. Identify them with arrows. (Remember that bacteria can use codons other than ATG as start codons and that a start and stop codon must be in the same reading frame.) c. Write out the mRNA transcribed from the longest orf? Make sure to label the 5' and 3' ends. d. Write out the peptide translated from the longest orf using the single letter code for amino acids.
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!