devR and hspX are two promoters controlled by DevR and PhoP. The strain LIX48 overexpresses (makes a lot of) DevR but no

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899603
Joined: Mon Aug 02, 2021 8:13 am

devR and hspX are two promoters controlled by DevR and PhoP. The strain LIX48 overexpresses (makes a lot of) DevR but no

Post by answerhappygod »

Devr And Hspx Are Two Promoters Controlled By Devr And Phop The Strain Lix48 Overexpresses Makes A Lot Of Devr But No 1
Devr And Hspx Are Two Promoters Controlled By Devr And Phop The Strain Lix48 Overexpresses Makes A Lot Of Devr But No 1 (69.38 KiB) Viewed 12 times
devR and hspX are two promoters controlled by
DevR and PhoP. The strain LIX48 overexpresses (makes a lot of) DevR
but not PhoP, while the strain LIX68 overexpresses both DevR and
PhoP. The fold induction is relative to a strain which does not
overexpress either gene.
Devr And Hspx Are Two Promoters Controlled By Devr And Phop The Strain Lix48 Overexpresses Makes A Lot Of Devr But No 2
Devr And Hspx Are Two Promoters Controlled By Devr And Phop The Strain Lix48 Overexpresses Makes A Lot Of Devr But No 2 (329.94 KiB) Viewed 12 times
QUESTION
You will need to make assumptions in your model (that’s why it’s
a model and not a definitive answer), so make sure to state
them.
devR hspx Fold induction wrt controls 6000- 5000- 4000- 3000- 1000- 800- 600- 400- 200- 0 LIX48 LIX68 (H37Ra::pJFR19-devR) (H37Ra::pJFR19-devR + pMV261-phoPRV) Figure 3. qRT-PCR analysis of M. tuberculosis H37Ra devR overex- pression strain complemented with phoPRV gene (LIX68). -Fold induc- tion of devR and hspX genes in LIX68 and its parent strain (LIX48) with respect to EV control strains (baseline expression set to 1.0) is shown. Results are presented as mean ± S.D. (error bars) of three independent experiments.
A. devS devR Rv3134c 27 bp B. Rv 3135 584 bp TH(+1) T1Rv3134c(TA) THHH 1P D 2 3 4 5 Rv3134cR Rv3134cF TH(+1) (SigC/SigA)-35 CTGGCGATAGAGGGTCCCCGCAACCAGGG ACTCCCGGCAATCAGGAATAG AGC -5 1 P D C. DevR 0 4 8 0 0 4 8 48 μM DevR-P 0 4 8 0 0 4 4 8 PhoP~P Ra PhoP 0 0 0 4 8 4 4 8 8 μM PhoP~P 0 0 0 4 8 4 4 8 8 4 8 μM F F➡ 6 7 8 9 1 2 3 4 5 6 7 8 9 1 2 3 4 5 Figure 4. DNA-binding studies of PhoP RR with Rv3134c-devR-devs promoter region. A, in silico analysis of the upstream region of Rv3134c-devR-devS operon revealed five putative sites for PhoP binding depicted as 1-5. Regulatory features including DevR binding boxes (P and D) and transcription start sites (aerobic and hypoxic) are indicated. Primers used for amplifying the 218-bp DNA probe for use in EMSAs are shown as half-arrows. B, binding of unphosphor- ylated DevR and PhoP proteins. C, binding of phosphorylated DevR, PhoP (left), and PhoP Ra (right) proteins to target DNA. Arrows, free DNA (F) and bound DNA. DevR box PhoP Binding site (Strong) 0 PhoP Binding site (weak) T2 8 CO μM μM
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Post Reply