2. A segment of DNA is known to contain the following base sequence: 3' GATACCTTTGTGTAGTCATCTT 5' a) Write the mRNA that

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899603
Joined: Mon Aug 02, 2021 8:13 am

2. A segment of DNA is known to contain the following base sequence: 3' GATACCTTTGTGTAGTCATCTT 5' a) Write the mRNA that

Post by answerhappygod »

2 A Segment Of Dna Is Known To Contain The Following Base Sequence 3 Gatacctttgtgtagtcatctt 5 A Write The Mrna That 1
2 A Segment Of Dna Is Known To Contain The Following Base Sequence 3 Gatacctttgtgtagtcatctt 5 A Write The Mrna That 1 (30.83 KiB) Viewed 11 times
2. A segment of DNA is known to contain the following base sequence: 3' GATACCTTTGTGTAGTCATCTT 5' a) Write the mRNA that would be transcribed from this DNA fragment. b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided. c) Where in the cell do transcription and translation occur?
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Top
Post Reply

Return to “Archived Questions & Answers”