Assume we are working in eukaryotes for the questions on this assignment. First, examine the length of double stranded D

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899604
Joined: Mon Aug 02, 2021 8:13 am

Assume we are working in eukaryotes for the questions on this assignment. First, examine the length of double stranded D

Post by answerhappygod »

Assume we are working in eukaryotes for the questions on this
assignment. First, examine the length of double stranded DNA found
below:
5’ – ATGCCGGTATATAGTTGATTTCCATGGATTTAA – 3’
3’ – TACGGCCATATATCAACTAAAGGTACCTAAATT – 5’
Question 1: Write out the pre-mRNA strand assuming the top DNA
strand above is the coding strand and the bottom strand is the
template strand.
Help on question 1 please
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Post Reply