Answer Question From Question 3 1 (392.33 KiB) Viewed 40 times
Answer Question From Question 3 2 (392.33 KiB) Viewed 40 times
aaggagttegaacctaaagacgtattgcccaatggggatgggacctaccagggctggataaccttggctgtaccccctggggaaga gcagagatatacgtgccaggtggagcacccaggcctggatcagcccctcattgtgatctggggtatgtgactgatgagagccagga gctgagaaaatctattgggggttgagaggagtgcctgaggaggtaattat c) Using the line diagram below, indicate where you would fine the Rsal sites on your PCR amplicons for a patient who is heterozygous for the C282Y mutation. Include the fragment sizes. [3] d) You analyse DNA samples with your PCR RFLP assay developed above, followed by agarose get electrophoresis. Draw the gel banding pattern with sizes you expect to observe for a wild type homozygote, mutant homozygote and heterozygote (carrier) individual respectively. [3] - WT/WT M/M WT/M I Sectlon D subtotal: 12 marks 7
aaggagttegaacctaaagacgtattgcccaatggggatgggacctaccagggctggataaccttggctgtaccccctggggaaga gcagagatatacgtgccaggtggagcacccaggcctggatcagcccctcattgtgatctggggtatgtgactgatgagagccagga gctgagaaaatctattgggggttgagaggagtgcctgaggaggtaattat c) Using the line diagram below, indicate where you would fine the Rsal sites on your PCR amplicons for a patient who is heterozygous for the C282Y mutation. Include the fragment sizes. [3] d) You analyse DNA samples with your PCR RFLP assay developed above, followed by agarose get electrophoresis. Draw the gel banding pattern with sizes you expect to observe for a wild type homozygote, mutant homozygote and heterozygote (carrier) individual respectively. [3] - WT/WT M/M WT/M I Sectlon D subtotal: 12 marks 7
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!