Answer only Question 3

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899604
Joined: Mon Aug 02, 2021 8:13 am

Answer only Question 3

Post by answerhappygod »

Answer only Question 3
Answer Only Question 3 1
Answer Only Question 3 1 (239.93 KiB) Viewed 47 times
Answer Only Question 3 2
Answer Only Question 3 2 (239.93 KiB) Viewed 47 times
Answer Only Question 3 3
Answer Only Question 3 3 (239.93 KiB) Viewed 47 times
Answer Only Question 3 4
Answer Only Question 3 4 (165.63 KiB) Viewed 47 times
Answer Only Question 3 5
Answer Only Question 3 5 (165.63 KiB) Viewed 47 times
Answer Only Question 3 6
Answer Only Question 3 6 (165.63 KiB) Viewed 47 times
be used for a restriction fragment length polymorphism (RFLP) diagnostic assay to identify Individuals with the C282Y mutation, and for cloning into a plasmid. acctatagaaggaagtgaaagttccagtcttcctggcaagggtaaacagatcccctctcctcatccttcctctttcctgtcaagtgcctc ctttggtgaaggtgacacatcatgtgacctcttcagtgaccactctacggtgtcgggocttgaactactacccccagaacatcaccato aagtggctgaaggataagcagccaatggatgccaaggagttegaacctaaagacgtattgcocaatggggatgggacctaccagg gctggataaccttggctgtaccccctggggaagagcagagathacgtgccaggtggagcacccaggcctggatcagcccctcatt gtgatctggggtatgtgactgatgagagccaggagctgagaaaatctattgggggttgagaggagtgcctgaggaggtaattatgg cagtgagatgaggatctgctctttgttagggggtgggctgaggg a) Design a primer set (forward & reverse primers of 17 nucleotides each) that will allow you to amplify only the sequence highlighted in grey above in your PCR reaction. [2] b) Does it matter whether you use genomic DNA or cDNA as template for the PCR? Motivate your answer. [2] c) General criteria for an effective primer pair include that the primer lengths should be appropriate (17-25 nucleotides), the G+C content of each primer should be 45-60%, and the melting temperatures (Tm) of the two members of the pair should not differ by >5°C (Tm = 2(A+T) + 4G+C). You use the Fp and Rp designed in 3.1 above, and the PCR results in suboptimal (low) amplification of the expected 400 bp product. Speculate as to one possible reason for this, and suggest a way of solving the problem. [2] d) What purpose does a buffer containing as Mg+2 or K+ ions have in step 2 of a standard three- step PCR reaction? [2]
be used for a restriction fragment length polymorphism (RFLP) diagnostic assay to identify Individuals with the C282Y mutation, and for cloning into a plasmid. acctatagaaggaagtgaaagttccagtcttcctggcaagggtaaacagatcccctctcctcatccttcctctttcctgtcaagtgcctc ctttggtgaaggtgacacatcatgtgacctcttcagtgaccactctacggtgtcgggocttgaactactacccccagaacatcaccato aagtggctgaaggataagcagccaatggatgccaaggagttegaacctaaagacgtattgcocaatggggatgggacctaccagg gctggataaccttggctgtaccccctggggaagagcagagathacgtgccaggtggagcacccaggcctggatcagcccctcatt gtgatctggggtatgtgactgatgagagccaggagctgagaaaatctattgggggttgagaggagtgcctgaggaggtaattatgg cagtgagatgaggatctgctctttgttagggggtgggctgaggg a) Design a primer set (forward & reverse primers of 17 nucleotides each) that will allow you to amplify only the sequence highlighted in grey above in your PCR reaction. [2] b) Does it matter whether you use genomic DNA or cDNA as template for the PCR? Motivate your answer. [2] c) General criteria for an effective primer pair include that the primer lengths should be appropriate (17-25 nucleotides), the G+C content of each primer should be 45-60%, and the melting temperatures (Tm) of the two members of the pair should not differ by >5°C (Tm = 2(A+T) + 4G+C). You use the Fp and Rp designed in 3.1 above, and the PCR results in suboptimal (low) amplification of the expected 400 bp product. Speculate as to one possible reason for this, and suggest a way of solving the problem. [2] d) What purpose does a buffer containing as Mg+2 or K+ ions have in step 2 of a standard three- step PCR reaction? [2]
be used for a restriction fragment length polymorphism (RFLP) diagnostic assay to identify Individuals with the C282Y mutation, and for cloning into a plasmid. acctatagaaggaagtgaaagttccagtcttcctggcaagggtaaacagatcccctctcctcatccttcctctttcctgtcaagtgcctc ctttggtgaaggtgacacatcatgtgacctcttcagtgaccactctacggtgtcgggocttgaactactacccccagaacatcaccato aagtggctgaaggataagcagccaatggatgccaaggagttegaacctaaagacgtattgcocaatggggatgggacctaccagg gctggataaccttggctgtaccccctggggaagagcagagathacgtgccaggtggagcacccaggcctggatcagcccctcatt gtgatctggggtatgtgactgatgagagccaggagctgagaaaatctattgggggttgagaggagtgcctgaggaggtaattatgg cagtgagatgaggatctgctctttgttagggggtgggctgaggg a) Design a primer set (forward & reverse primers of 17 nucleotides each) that will allow you to amplify only the sequence highlighted in grey above in your PCR reaction. [2] b) Does it matter whether you use genomic DNA or cDNA as template for the PCR? Motivate your answer. [2] c) General criteria for an effective primer pair include that the primer lengths should be appropriate (17-25 nucleotides), the G+C content of each primer should be 45-60%, and the melting temperatures (Tm) of the two members of the pair should not differ by >5°C (Tm = 2(A+T) + 4G+C). You use the Fp and Rp designed in 3.1 above, and the PCR results in suboptimal (low) amplification of the expected 400 bp product. Speculate as to one possible reason for this, and suggest a way of solving the problem. [2] d) What purpose does a buffer containing as Mg+2 or K+ ions have in step 2 of a standard three- step PCR reaction? [2]
b) The sequence below represents the 400 bp PCR amplicon of the HFE WT allele. Indicate the position and nature of the point mutation responsible for the C282Y mutation. Use a yellow highlight to Indicate the potential recognition site(s) for the enzyme Rsal. [2] ggcaagggtaaacagatcccctctcctcatccttcctctttcctgtcaagtgcctcctttggtgaaggtgacacatcatgtgacctcttca gtgaccactctacggtgtcgggccttgaactactacccccagaacatcaccatgaagtggctgaaggataagcagccaatggatgce baggagttegaacctaaagacgtattgcccaatggggatgggacctaccagggctggataaccttggctgtaccocctggggaaga gcagagatatacgtgccaggtggagcacccaggcctggatcagcccctcattatgatctggggtatgtgactgatgagagccagga actoagaaaatctattagggattgagaggagtgcctgaggagataattat c) Using the line diagram below, indicate where you would fine the Rsal sites on your PCR ampllcons for a patient who is heterozygous for the C282Y mutation. Include the fragment sizes. [3] d) You analyse DNA samples with your PCR RFLP assay developed above, followed by agarose gel electrophoresis. Draw the gel banding pattern with sizes you expect to observe for a wild type homozygote, mutant homozygote and heterozygote (carrier) individual respectively. [3] WT/WT M/M WT/M Section D subtotal: 12 marks 7 +
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Post Reply