PART 1: Several species. (10 points) Print out the gene names for all genes belonging to Drosophila melanogaster or Dros

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899604
Joined: Mon Aug 02, 2021 8:13 am

PART 1: Several species. (10 points) Print out the gene names for all genes belonging to Drosophila melanogaster or Dros

Post by answerhappygod »

Part 1 Several Species 10 Points Print Out The Gene Names For All Genes Belonging To Drosophila Melanogaster Or Dros 1
Part 1 Several Species 10 Points Print Out The Gene Names For All Genes Belonging To Drosophila Melanogaster Or Dros 1 (19.39 KiB) Viewed 56 times
Part 1 Several Species 10 Points Print Out The Gene Names For All Genes Belonging To Drosophila Melanogaster Or Dros 2
Part 1 Several Species 10 Points Print Out The Gene Names For All Genes Belonging To Drosophila Melanogaster Or Dros 2 (19.39 KiB) Viewed 56 times
Part 1 Several Species 10 Points Print Out The Gene Names For All Genes Belonging To Drosophila Melanogaster Or Dros 3
Part 1 Several Species 10 Points Print Out The Gene Names For All Genes Belonging To Drosophila Melanogaster Or Dros 3 (32.14 KiB) Viewed 56 times
Part 1 Several Species 10 Points Print Out The Gene Names For All Genes Belonging To Drosophila Melanogaster Or Dros 4
Part 1 Several Species 10 Points Print Out The Gene Names For All Genes Belonging To Drosophila Melanogaster Or Dros 4 (18.47 KiB) Viewed 56 times
Part 1 Several Species 10 Points Print Out The Gene Names For All Genes Belonging To Drosophila Melanogaster Or Dros 5
Part 1 Several Species 10 Points Print Out The Gene Names For All Genes Belonging To Drosophila Melanogaster Or Dros 5 (18.47 KiB) Viewed 56 times
PART 1: Several species. (10 points) Print out the gene names for all genes belonging to Drosophila melanogaster or Drosophila simulans. PART 2: Length range. (10 points) Print out the gene names for all genes between 90 and 110 bases long.

H UTF-8"data ☆ Saved to Drive File Edit View Insert Format Data Tools Extensions Help Last edit was seconds ago Default (Ari.. 10 B T & A 100%- $ .00 123- fx Drosophila melanogaster E.I. A1 A B 1 2 3 Drosophila melanogaster Drosophila melanogaster Drosophila simulans Drosophila yakuba Drosophila ananassa Drosophila ananassae atatatatategogtatatatacgactatatgcattaattatagcat: kdy647 actgigacgtgtactgracgactatcgatacgtagtactgategetjdg766 atcgatcatgtcgategatgatgcatocgactatcgtegatcgtgi kdy533 cgcgcgctcgcgcatacggcctantgegcgcgctagcgatge hdt739 tracgatcgategatcgatogatogtogatogtogatgctacatchdu045 gcatcatcgategoggcgcatcgategogatcategatcatac teg436 264 185 485 85 356 222 4

FX Drosophila melanogaster Drosophila melanogaster Drosophila melanogaster Drosophila simulans Drosophila yakuba Drosophila ananasse Drosophila ananassa atatatatata attacgacatacattatatag at gati dy647 actigacglo ogacta contactatacatectact 09766 atacagtogatgalgagcatcgactatcggiatega kdy533 cgcgoctogogcatacgoccategoggctacoat 739 tagatgacgatgalega cotcgatgetacato alcanhduo45 gatogatogatog goccato gatalogatcatacgogte 9436 264 185 485 05 222
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Post Reply