DNA, the carrier of genetic information in living things, has
been used in criminal justice for decades. But how, exactly, does
DNA profiling work? Given a sequence of DNA, how can forensic
investigators identify to whom it belongs?
Well, DNA is really just a sequence of molecules called
nucleotides, arranged into a particular shape (a double helix).
Each nucleotide of DNA contains one of four different bases:
adenine (A), cytosine (C), guanine (G), or thymine (T). Every human
cell has billions of these nucleotides arranged in sequence. Some
portions of this sequence (i.e. genome) are the same, or at least
very similar, across almost all humans, but other portions of the
sequence have a higher genetic diversity and thus vary more across
the population.
One place where DNA tends to have high genetic diversity is in
Short Tandem Repeats (STRs). An STR is a short sequence of DNA
bases that tends to be repeated back-to-back numerous times at
specific locations in DNA. The number of times any particular STR
repeats varies a lot among different people. In the DNA samples
below, for example, Alice has the STR AGAT repeated four times in
her DNA, while Bob has the same STR repeated five times.
Alice: CTAGATAGATAGATAGATGACTA
Bob: CTAGATAGATAGATAGATT
Using multiple STRs, rather than just one, can improve the
accuracy of DNA profiling. If the probability that two people have
the same number of repeats for a single STR is 5%, and the analyst
looks at 10 different STRs, then the probability that two DNA
samples match purely by chance is about 1 in 1 quadrillion
(assuming all STRs are independent of each other). So if two DNA
samples match in the number of repeats for each of the STRs, the
analyst can be pretty confident they came from the same person.
CODIS, The FBI's DNA database, uses 20 different STRs as part of
its DNA profiling process.
TASK Define a function
named computeLCS that receives a long
DNA sequence and a STR (like AGAT, AATG, or TATC). The function
returns the number of times the STR is repeated back-to-back within
the DNA sequence. This is a core function that can be used in DNA
profiling as discussed above.
# Define a function to compute longest consecutive sequence
def computeLCS(dna_sequence, STR):
# TODO - compute and return the longest
consecutive occurrence
if __name__ == "__main__" :
dna_sequence = input() # obtain DNA sequence
STR = input() # obtain STR from input (ex. AGAT
)
# compute the number of consecutive occurrence of STR in the
string dna_sequence
print (computeLCS (dna_sequence, STR) )
DNA, the carrier of genetic information in living things, has been used in criminal justice for decades. But how, exactl
-
answerhappygod
- Site Admin
- Posts: 899604
- Joined: Mon Aug 02, 2021 8:13 am
DNA, the carrier of genetic information in living things, has been used in criminal justice for decades. But how, exactl
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!