As Objectives: The objective of this Lab Assignment is to use conditional tests. you have learned already, the best appr

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899604
Joined: Mon Aug 02, 2021 8:13 am

As Objectives: The objective of this Lab Assignment is to use conditional tests. you have learned already, the best appr

Post by answerhappygod »

As Objectives The Objective Of This Lab Assignment Is To Use Conditional Tests You Have Learned Already The Best Appr 1
As Objectives The Objective Of This Lab Assignment Is To Use Conditional Tests You Have Learned Already The Best Appr 1 (158.11 KiB) Viewed 38 times
data.csv
Drosophila melanogaster,atatatatatcgcgtatatatacgactatatgcattaattatagcatatcgatatatatatcgatattatatcgcattatacgcgcgtaattatatcgcgtaattacga,kdy647,264 Drosophila melanogaster,actgtgacgtgtactgtacgactatcgatacgtagtactgatcgctactgtaatgcatccatgctgacgtatctaagt,jdg766,185 Drosophila simulans,atcgatcatgtcgatcgatgatgcatccgactatcgtcgatcgtgatcgatcgatcgatcatcgatcgatgtcgatcatgtcgatatcgt,kdy533,485 Drosophila yakuba,cgcgcgctcgcgcatacggcctaatgcgcgcgctagcgatgc,hdt739,85 Drosophila ananassae,ttacgatcgatcgatcgatcgatcgtcgatcgtcgatgctacatcgatcatcatcggattagtcacatcgatcgatcatcgactgatcgtcgatcgtagatgctgacatcgatagca,hdu045,356 Drosophila ananassae,gcatcgatcgatcgcggcgcatcgatcgcgatcatcgatcatacgcgtcatatctatacgtcactgccgcgcgtatctacgcgatgactagctagact,teg436,222
code in python
As Objectives: The objective of this Lab Assignment is to use conditional tests. you have learned already, the best approach to solve a problem is to break it down into individual steps. Do not forget about what you have previously learned and seen. This assignment will be asking you to use the knowledge you have acquired since the beginning of the semester. Use the text file called data.csv from Blackboard, it contains some made-up data for a number of genes. Each line has the following fields for a single gene in this order: species name, sequence, gene name, expression level. The fields are separated by commas (hence the name of the file - csv stands for Comma Separated Values). Think of it as a representation of a table in a spreadsheet - each line is a row, and each field in a line is a column. All the exercises for this chapter use the data in this file. This is a multi part exercise, which involves extracting and printing data from the file. The nature of this type of problem means that it's quite easy to get a program that runs without errors, but doesn't quite produce the correct output, so be sure to check your solutions manually. PART 1: Several Species. (10 points) Print out the gene names for all genes belonging to Drosophila melanogaster or Drosophila simulans. PART 2: Length range. (10 points) Print out the gene names for all genes between 90 and 110 bases long.
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Post Reply