GTGGCCAAGAGGGAAAGCCGGGGCCTCAAGTCTGGCCTCAAGACCGACAAGTCGGACTCGGAG CAAGT GACGCTCCGCATCCATCGGAAAAACGCCCCGGCAGGAGGCAGCGGGATGG

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899604
Joined: Mon Aug 02, 2021 8:13 am

GTGGCCAAGAGGGAAAGCCGGGGCCTCAAGTCTGGCCTCAAGACCGACAAGTCGGACTCGGAG CAAGT GACGCTCCGCATCCATCGGAAAAACGCCCCGGCAGGAGGCAGCGGGATGG

Post by answerhappygod »

Gtggccaagagggaaagccggggcctcaagtctggcctcaagaccgacaagtcggactcggag Caagt Gacgctccgcatccatcggaaaaacgccccggcaggaggcagcgggatgg 1
Gtggccaagagggaaagccggggcctcaagtctggcctcaagaccgacaagtcggactcggag Caagt Gacgctccgcatccatcggaaaaacgccccggcaggaggcagcgggatgg 1 (41.35 KiB) Viewed 27 times
GTGGCCAAGAGGGAAAGCCGGGGCCTCAAGTCTGGCCTCAAGACCGACAAGTCGGACTCGGAG CAAGT GACGCTCCGCATCCATCGGAAAAACGCCCCGGCAGGAGGCAGCGGGATGGCCAGCGCCAAGAC CAAGACG CACTTCTCAGTGAGGCTCCTCAAGTTCTCCCGGGAGAAGAAAGCGGCCAAAACGCTGGGC a) Identify the unknown sequence. What are the name and the accession number of the gene identified. (2 points) b) How many open reading frames are found in this sequence? (1 points) c) Search the protein of that gene infUniProt database. Write down the Uniprot ID and GO- Molecular functions. (3 points) d) Write down the exact name(s) of the specific software(s)/program(s) you used to answer the questions. (1.5 point)
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Post Reply