highighted in yellow. introns are shown in red. The cleavage site is in green. 5′ - TCCATAT CCGTATGCGGCCTAGC CITGTAGATGA
-
answerhappygod
- Site Admin
- Posts: 899604
- Joined: Mon Aug 02, 2021 8:13 am
highighted in yellow. introns are shown in red. The cleavage site is in green. 5′ - TCCATAT CCGTATGCGGCCTAGC CITGTAGATGA
highighted in yellow. introns are shown in red. The cleavage site is in green. 5′ - TCCATAT CCGTATGCGGCCTAGC CITGTAGATGAGACCTGGCATGC + 3 3' - AGGTATAGGCATACGCCGGATCG GAACATCT ACTCTGGACCGTACG - 5 Instructions: a) (4 pts) Copy \& paste the DNA sequence into the answer box, then label the template and coding DNA strands and highlight the promoter and regions. Make it clear what you are labeling (use different colors) and highlight the whole sequence, not just the first base-pair. b) (2 pt5) Transcribe the gene, showing the initial pre-mRNA that has not undergone any editing. Make sure you start and end transcription in the right place! c) (4 pts) Now draw the mature mRNA that has been processed and is ready to leave the nucleus. Clearly label 3′ and 5′ ends.
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!