As a student in a lab, you are provided DNA with the sequence that is shown below. Your mentor asks that you design DNA

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899604
Joined: Mon Aug 02, 2021 8:13 am

As a student in a lab, you are provided DNA with the sequence that is shown below. Your mentor asks that you design DNA

Post by answerhappygod »

As A Student In A Lab You Are Provided Dna With The Sequence That Is Shown Below Your Mentor Asks That You Design Dna 1
As A Student In A Lab You Are Provided Dna With The Sequence That Is Shown Below Your Mentor Asks That You Design Dna 1 (78.41 KiB) Viewed 21 times
As a student in a lab, you are provided DNA with the sequence that is shown below. Your mentor asks that you design DNA primers to amplify the bold and underlined region of the DNA by PCR. Provide the 10 nucleotide sequence of the primers that you would design and indicate the 5′ and 3' ends of each primer. (1) ATTGTATCCGCATTTGATGCTACCGTGGTTGAGTCAGCGTCGAGCACGCGGCACTTATTGCATGAGTAGAGTTGA CTAAGAGCCGTTAGATGCCTCGCTGTACTAATAGTTGTCGACAGATCGTCAAGATTAGAAAACGGTAGCAGCAT TATCGGAGGTTCTCTAACTAGTATGGATAGCCGTGTCTTCACTGTGCTGCGGCTACCCATCGCCTGAAAACCAGTT GGTGTTAAGCGATCCCCTGTCCAGGACGCCACACGTAGTGAAACAT What is the Tm and annealing temperature? (1)
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Top
Post Reply

Return to “Archived Questions & Answers”