- 1 Complete The Box Below Use The Attached Table Make Sure You Read The Columns In The Table Carefully Amino Acid Sym 1 (422.72 KiB) Viewed 67 times
1. Complete the box below. Use the attached table. Make sure you read the columns in the table carefully! AMINO ACID SYM
-
- Site Admin
- Posts: 899603
- Joined: Mon Aug 02, 2021 8:13 am
1. Complete the box below. Use the attached table. Make sure you read the columns in the table carefully! AMINO ACID SYM
1. Complete the box below. Use the attached table. Make sure you read the columns in the table carefully! AMINO ACID SYMBOL AMINO ACID Alanine Arginine Asparagine Aspartic acid Cysteine Glutamine Glutamic acid Ala Arg Asn Asp Cys Gln Glu Gly His Ile Leu Lys Met Phe Pro Ser Thr Trp Tyr Val Terminating triplets DNA template strand mRNA tRNA Amino Acid Glycine Histidine Isoleucine Leucine Lysine Methionine Phenylalanine Proline Serine Threonine Tryptophan Tyrosine Valine DNA TRIPLET CGA, CGG, CGT, CGC GCA, GCG, GCT, GCC, TCT, TCC TTA, TTG CTA, CTG ACA, ACG GTT, GTC CTT, CTC CCA, CCG, CCT, CCC GTA, GTG TAA, TAG, TAT AAT, AAC, GAA, GAG, GAT, GAC TTT, TTC TAC AAA, AAG GGA, GGG, GGT, GGC AGA, AGG, AGT, AGC, TCA, TCG TGA, TGG, TGT, TGC ACC ATA, ATG CAA, CAG, CAT, CAC ATT, ATC, ACT TAC CGG AAU 2. Convert the following template strand of DNA bases into its complementary mRNA molecule. Next translate the DNA into a polypeptide chain of amino acids using the Table above. CAATATGGAAGCCGACTCACCCTAATT