quence landmarks T otion start aling sequence ling sequence ning sites Kho I) aling sequence or sequence in sequence 370

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899603
Joined: Mon Aug 02, 2021 8:13 am

quence landmarks T otion start aling sequence ling sequence ning sites Kho I) aling sequence or sequence in sequence 370

Post by answerhappygod »

Quence Landmarks T Otion Start Aling Sequence Ling Sequence Ning Sites Kho I Aling Sequence Or Sequence In Sequence 370 1
Quence Landmarks T Otion Start Aling Sequence Ling Sequence Ning Sites Kho I Aling Sequence Or Sequence In Sequence 370 1 (48.84 KiB) Viewed 38 times
4.1. How many fragments will form if pET28a(+) is digested simultaneously with Sac and Bcll.4.2. Write down the base pairs that result at the 5' and 3' ends of the shortest fragment[314.3. Restriction enzymes often recognize palindromic sequences. What is a palindromic sequence? [2]4.4. Give three restriction enzymes found on the pET28(a+) multiple cloning site.[3]
4.1. How many fragments will form if pET28a(+) is digested simultaneously with Sac and Bcll.
4.2. Write down the base pairs that result at the 5' and 3' ends of the shortest fragment
[31
4.3. Restriction enzymes often recognize palindromic sequences. What is a palindromic sequence? [2]
4.4. Give three restriction enzymes found on the pET28(a+) multiple cloning site.
[3]
quence landmarks T otion start aling sequence ling sequence ning sites Kho I) aling sequence or sequence in sequence 370-386 369 270-287 207-239 158-203 140-157 26-72 773-1852 3286 3995-4807 4903-5358 or pET-28b(+) and pET-28c(+) e as pET-28a(+) (shown) with mg exceptions: pET-28b(+) is a mid; subtract 1bp from each site nH I at 198. pET-28c(+) is a mid; subtract 2bp from each site nH I at 198. Nco PET upstream primer #69214-3 Bo Pvulie125), Sgf (4426) Smal(4300) Cla 4117) Nru (4083) Eco57 13772) AlwN13640) BssS (397) 17 promoter primer 46348-3 17 promoter Dra Ill5127) (208-966) BspLU11 (224) tac operator 11 origin (4903-5358) ori (3286) Sap (108) Bst1107 (2995) Th11122963 Ap11021 His-Tag TATACCATOGGCAGCAGCCATCATCATCATCATCACAGCAGEGGOCT SCCGCOCOOCACCATA AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTOTGAGCOGATARCASTICCCCTETAGARSTARTTITO Bal PET-28a(+) (5369bp) NdeL Nhel thrombin His-Tag GGTOGGATCCGAATTOGAGETCOGTCGACAAGUTTGCGGCCGCACTEGAGCACCACC MetlySerSeriSHISHISHISHISHIsSerSerGlyLeValProrlesetarethelyi Bpu1102 (80) 17-Tag TACCATGACTOGTOGACAGCA MetlyArgySeriuPheGluteurgarginalaysGlyArgThrArgoProProProProProleurgeryCysEnd GOTOGGGATCCGAATTOGASCTCCGTCGACA&GETTOCOOCOOCAL TEGAGE GlyArgAspPreAsnSer SerSer ValasplysLeulleAlokiseutuishikishind Xho (158) Not (166) Eag (166) Hind (173) Sal (179) Sac (190) EcoR (192) BamH (196) Nhe (231) Nde (238) Nco (296) -Xoa 1935) Bgl (401) SgrA (442) Sph (508) rbs TTAGARUGAGA Eag! BamHI EcoRL Sacl Sall Hind Not Xhel ATGGOTCOCOGATCCGARTTCGAGCFCCGTCGACAAGETTO COCCOCACTCCASCACCACCACCACCACEACTGAGATCEGOCTOCTAACAAAGCCC DET-281-1 DET-286(+) ACCACTGAGATOCGGETGCTAACAAAGCCC DET-281-1 GlyArgileArgileArgAloProßer ThrerLeuArgProfiserer The The Thr The ThrThralulleArgLeuteuThrLysPro. 17 terminator GARACCARGETGAGTTGGETOETOCCACCOCTGAGEAATAACTAGCATAACCCCTTOOGGETOTARACOOGTETTGAG 17 terminator primer #8337-3 CCACCACEACTEAGATOCGOCTOCTARCARAGCCC PET-28a-c(+) cloning/expression region lacl (773-1852) -Bgl (2187) Fsp (2205) Psp5 (2230) Mlu (1123) Bel (1137) BstE (1304) Apa (1334) PshA I(1968) BasH (1534) EcoR V(1573) Hpa (1629)
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Post Reply