1. Below is the DNA sequence of two hypothetical virus. These two viruses have same DNA sequence except in the sequence

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899603
Joined: Mon Aug 02, 2021 8:13 am

1. Below is the DNA sequence of two hypothetical virus. These two viruses have same DNA sequence except in the sequence

Post by answerhappygod »

1. Below is the DNA sequence of two hypotheticalvirus. These two viruses have same DNA sequence except in thesequence that are indicated by bold letters are different. How willyou detect the two viruses simultaneously? Write the primersequences that will be used to detect both the virus and illustratethe results with a diagram when either of them is present or bothare present the sample. Explain the diagram briefly
Virus A
121 ttggtggtga ggccctgggc aggttggtat caaggttaca agacaggtttaaggagacca
Virus B
121 ttggtggtga ggccctgggc aggttggtat caaggttaca agacaggtttaaggagacca
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Top
Post Reply

Return to “Archived Questions & Answers”