- 4 Which Of The Following Dna Sequences Contain S A Mutation A Tcaa B Cagc C Aatt D Gata Agtt Gtcg Ttaa Ctct 5 Gi 1 (111.65 KiB) Viewed 12 times
4. Which of the following DNA sequences contain(s) a mutation? a) TCAA b) CAGC c) AATT d) GATA AGTT GTCG TTAA CTCT 5. Gi
-
- Site Admin
- Posts: 899603
- Joined: Mon Aug 02, 2021 8:13 am
4. Which of the following DNA sequences contain(s) a mutation? a) TCAA b) CAGC c) AATT d) GATA AGTT GTCG TTAA CTCT 5. Gi
4. Which of the following DNA sequences contain(s) a mutation? a) TCAA b) CAGC c) AATT d) GATA AGTT GTCG TTAA CTCT 5. Given the following sequence of a portion of a DNA strand, determine the sequence of a complementary strand of mRNA: TACCCGTATACGATATGGTCAAG 6. Given the following sequence for a strand of mRNA, what would the resulting amino acid sequence be? AUG AAA CGG CAA CCA UUG AUC GAU 7. Point mutations are sources of error in DNA replication. Shown below are five mRNA sequences, including one “normal” sequence and four different point mutations. Circle the codon where a mutation has occurred. Then use the genetic code table to note the effect the mutation will have on protein synthesis (e.g., different protein, no protein, neutral effect, etc.) Normal mRNA strand: Point mutation #1: Point mutation #2: Point mutation #3: AUG AAA CAU GCA CUA AUG UAA lys his ala leu met stop start and met AUG UAA CAU GCA CUA AUG UAA AUG AAA CAU CCA CUA AUG UAA AUG AAA CAU GCA CUA AUG AAA