there are four blanks in the questions

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899603
Joined: Mon Aug 02, 2021 8:13 am

there are four blanks in the questions

Post by answerhappygod »

there are four blanks in the questions
There Are Four Blanks In The Questions 1
There Are Four Blanks In The Questions 1 (47.73 KiB) Viewed 53 times
There Are Four Blanks In The Questions 2
There Are Four Blanks In The Questions 2 (47.73 KiB) Viewed 53 times
A promoter re- gion can be blocked by an- other protein. Histone deacetylation can pre- vent DNA from unwinding. Alternative splicing within the gene Start sequence can lead to different forms wedd gene ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA ▬▬▬▬▬▬▬▬▬▬▬▬▬ Stop TACTGCCTAGTO CGTTCGCCTTAACCGCTGTATT A possible location for a regulatory region that can be bound and increase transcription rates.
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Top
Post Reply

Return to “Archived Questions & Answers”