There Are Four Blanks In The Questions 1 (47.73 KiB) Viewed 53 times
There Are Four Blanks In The Questions 2 (47.73 KiB) Viewed 53 times
A promoter re- gion can be blocked by an- other protein. Histone deacetylation can pre- vent DNA from unwinding. Alternative splicing within the gene Start sequence can lead to different forms wedd gene ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA ▬▬▬▬▬▬▬▬▬▬▬▬▬ Stop TACTGCCTAGTO CGTTCGCCTTAACCGCTGTATT A possible location for a regulatory region that can be bound and increase transcription rates.
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!