Given below coding sequence from a gene. cttgagacccttgagaacatccttgaggcagac What will be the resulting polypeptide sequen

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899603
Joined: Mon Aug 02, 2021 8:13 am

Given below coding sequence from a gene. cttgagacccttgagaacatccttgaggcagac What will be the resulting polypeptide sequen

Post by answerhappygod »

Given Below Coding Sequence From A Gene Cttgagacccttgagaacatccttgaggcagac What Will Be The Resulting Polypeptide Sequen 1
Given Below Coding Sequence From A Gene Cttgagacccttgagaacatccttgaggcagac What Will Be The Resulting Polypeptide Sequen 1 (9.01 KiB) Viewed 60 times
Given below coding sequence from a gene. cttgagacccttgagaacatccttgaggcagac What will be the resulting polypeptide sequence? Note: Normally you find the start codon in the mRNA, however, for this question, start from the very first letter. Answer using one-letter symbols of amino acids and no spaces. Example: ACDEFG
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Post Reply