Examine the results of the blast search shown below and answer the question. Mus musculus phosphofructokinase, liver, B-

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899603
Joined: Mon Aug 02, 2021 8:13 am

Examine the results of the blast search shown below and answer the question. Mus musculus phosphofructokinase, liver, B-

Post by answerhappygod »

Examine The Results Of The Blast Search Shown Below And Answer The Question Mus Musculus Phosphofructokinase Liver B 1
Examine The Results Of The Blast Search Shown Below And Answer The Question Mus Musculus Phosphofructokinase Liver B 1 (380.08 KiB) Viewed 10 times
Examine the results of the blast search shown below and answer the question. Mus musculus phosphofructokinase, liver, B-type (Pfkl), transcript variant 1, mRNA Sequence ID: NM_008826.5 Length: 3752 Number of Matches: 1 Range 1: 125 to 202 GenBank Graphics Next Match Previous Match Expect Identities Gaps Strand 7e-31 78/78(100%) 0/78(0%) Plus/Plus ATGGCTACCGTGGACCTGGAGAAACTGCGGATGTCGGGGGCTGGCAAGGCCATTGGAGTG 60 Score 145 bits(78) Query 1 Sbjct 125 Query 61 Sbjct 185 ATGGCTACCGTGGACCTGGAGAAACTGCGGATGTCGGGGGCTGGCAAGGCCATTGGAGTG 184 CTGACCAGCGGCGGTGAT 78 CTGACCAGCGGCGGTGAT 202 What is the organism in which the BLAST search found a perfect match? O Phosphofructokinase O Homo sapiens O Mus musculus OPfkl Question 14 Dideoxynucleotides are used in which process? O next generation sequencing O PCR O molecular cloning O chain termination sequencing
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Post Reply