a) Provide the recognition site and cleavage position of Rsal in dsDNA. What type of ends are generated by this enzyme?

[answerhappygod]

A Provide The Recognition Site And Cleavage Position Of Rsal In Dsdna What Type Of Ends Are Generated By This Enzyme 1 (171.25 KiB) Viewed 40 times

a) Provide the recognition site and cleavage position of Rsal in dsDNA. What type of ends are generated by this enzyme? [2] b) The sequence below represents the 400 bp PCR amplicon of the HFE WT allele. Indicate the position and nature of the point mutation responsible for the C282Y mutation. Use a yellow highlight to indicate the potential recognition site(s) for the enzyme Rsal. [2] ggcaagggtaaacagatcccctctcctcatccttcctctttcctgtcaag gectectetggtgaaggtgacacatcatgtgacctcttca gtgaccactctacggtgtcgggccttgaactactacdcccagaacatcaccatgaagtggctgaaggataagcagccaatggatgea aaggagttegaacetaaagacgtattgcecaatggggatgggacctaccagggctggataaccttggctgtacoccetggggaaga gcagagatatacgtgccaggtggagcacccaggcctggatcagcccctcattgtgatotggggtatgtgactgatgagagccagga gctgagaaaatctattgggggttgagaggagtgcctgaggaggtaattat c) Using the line diagram below, indicate where you would fine the Rsal sites on your PCR amplicons for a patient who is heterozygous for the C282Y mutation. Include the fragment sizes. [3] d) You analyse DNA samples with your PCR RFLP assay developed above, followed by agarose gel electrophoresis. Draw the gel banding pattern with sizes you expect to observe for a wild type homozygote, mutant homozygote and heterozygote (carrier) individual respectively. [3]