Question 71 Refer to the DNA molecule below and translate the first 5 aminoacids (5 points) Second Letter UUU UAY Ser UG

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899604
Joined: Mon Aug 02, 2021 8:13 am

Question 71 Refer to the DNA molecule below and translate the first 5 aminoacids (5 points) Second Letter UUU UAY Ser UG

Post by answerhappygod »

Question 71 Refer To The Dna Molecule Below And Translate The First 5 Aminoacids 5 Points Second Letter Uuu Uay Ser Ug 1
Question 71 Refer To The Dna Molecule Below And Translate The First 5 Aminoacids 5 Points Second Letter Uuu Uay Ser Ug 1 (31.9 KiB) Viewed 69 times
Question 71 Refer to the DNA molecule below and translate the first 5 aminoacids (5 points) Second Letter UUU UAY Ser UGC) U CUC c CAC His CGA Ang First letter UUG -Pthe UCU UCC UAC UUA UCA Lou UUGU UAA Stop UGA Stop A UCG UAG Stop UGOTI CUU CCU CAU CGU ССС CUA Lou CCA Pro CGC CAA CUG CCO CAGJ Gin CGG AUU ACU AUC te ACC AAC AUA ACA Thr AAA AGA AUG Met ACG GUU GCU GAU) GGU GUC Val GCC Ala GGC GUA GCA GAA GUG GCG) GAG Glu GGG Ass AGUS >ი: იაილ იაილი: Third letter A AAG] Lys AGGJARO GAC Asp GGA 'Gly G DNA: 3'TACTGATCGACCCCCATAATGAAAATC 5 it Format Table Paragraph B U A ou T
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Post Reply