2. a) What is the reason for the following microsatellite? b) Indicates the number of repetitions of the motif in the fo

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899604
Joined: Mon Aug 02, 2021 8:13 am

2. a) What is the reason for the following microsatellite? b) Indicates the number of repetitions of the motif in the fo

Post by answerhappygod »

2. a) What is the reason for the following microsatellite? b) Indicates the number of repetitions of the motif in the following microsatellite and c) Indicates the number of base pairs (bp) of the following microsatellite. (6pts) <- AGCTACATACATACATACATACATACATACAGCT -> <- TCGATGTATGTATGTATGTATGTATGTATGTCGA ->
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Top
Post Reply

Return to “Archived Questions & Answers”