Given the following prokaryote sequence of DNA: Identify if any promoter sequences are present in DNA SEQ1 (Highlight/Un

[answerhappygod]

Given the following prokaryote sequence of DNA: Identify if any
promoter sequences are present in DNA SEQ1 (Highlight/Underline
these in the sequence) Predict the mRNA sequence that would arise
from this DNA sequence. Identify the ribosome binding site, start
and stop codons (if present). (Highlight/Underline these in the
sequence). Predict the sequence of the peptide that would arise
from the predicted mRNA sequence using the genetic code table (see
Codon usage table). Based on your knowledge of the properties of
amino acids speculate on the properties of the predicted peptide
(e.g. charge, hydrophobicity, aromaticity)
5’TGGCCTTAATCTTACTTTGACAATCCGCTTGACTTTCGATCTATAATAGCTTAGGTAATTGGAGGGTTTCGCATGGTTATCATATCTCCCACCCGCCGCTTTAGGCTAAGACCTGTGATGGACTTTTGATC
3’