Given the following prokaryote sequence of DNA Identify if any promoter sequences are present in DNA SEO1 Highlight/Unde

Business, Finance, Economics, Accounting, Operations Management, Computer Science, Electrical Engineering, Mechanical Engineering, Civil Engineering, Chemical Engineering, Algebra, Precalculus, Statistics and Probabilty, Advanced Math, Physics, Chemistry, Biology, Nursing, Psychology, Certifications, Tests, Prep, and more.
Post Reply
answerhappygod
Site Admin
Posts: 899604
Joined: Mon Aug 02, 2021 8:13 am

Given the following prokaryote sequence of DNA Identify if any promoter sequences are present in DNA SEO1 Highlight/Unde

Post by answerhappygod »

Given The Following Prokaryote Sequence Of Dna Identify If Any Promoter Sequences Are Present In Dna Seo1 Highlight Unde 1
Given The Following Prokaryote Sequence Of Dna Identify If Any Promoter Sequences Are Present In Dna Seo1 Highlight Unde 1 (22.02 KiB) Viewed 268 times
Given the following prokaryote sequence of DNA Identify if any promoter sequences are present in DNA SEO1 Highlight/Underline these in e in the sequence Predict the mRNA sequence that would arise from this DNA sequence Identify the ribosome binding site, start and stop codons (if present), CHighlight Underline these in the sequences Predict the sequence of the peptide that would arise from the predicted mRNA sequence using the genetic code table isee Codon usage table Based on your knowledge of the properties of amino acids speculate on the properties of the predicted peptideleg charge, hydrophobicity, aromaticity STAAAATCACCTTTCATTGACACCACAATCACATCTCTACGTATAATGAATTTAAAGCGGAGGCAAATTTGOCCCCCAATGCITITIGICGACITCGACITTAATGCTOMMAGGAGGCAMATGAAMACIT 3
Join a community of subject matter experts. Register for FREE to view solutions, replies, and use search function. Request answer by replying!
Top
Post Reply

Return to “Archived Questions & Answers”