Page 1 of 1
1. Below is a mature eukaryotic mRNA transcript. Translate this mRNA into a protein. Make sure you start and end transla
Posted: Fri Jul 15, 2022 5:20 pm
by answerhappygod
- 1 Below Is A Mature Eukaryotic Mrna Transcript Translate This Mrna Into A Protein Make Sure You Start And End Transla 1 (38.11 KiB) Viewed 35 times
1. Below is a mature eukaryotic mRNA transcript. Translate this mRNA into a protein. Make sure you start and end translation in the right place! I abel the ends of the polypeptide chain as N and C terminus. mRNA: 5' GUUACAUGCGGCGACUCAGUUGAGGCGAAAAAA 3' amino acids: 2. For each of the following mRNA codons, give the tRNA anticodon that would bind to it. Include polarity ( 5 ' and 3′ ends) Codons: Anticodons: 5'GCA3' 5'UAC3' 5′CUC′ 3. Explain the key steps that occur in each phase of eukaryotic translation and list the major differences in bacterial translation for each phase (except elongation, where there is practically no difference). Initiation: How bacterial initiation differs: Elongation: Termination: How bacterial termination differs: