Note this is NOT a file submission question. Please type your answers in the provided spaces. Shown below is a eukaryoti
Posted: Fri Jul 15, 2022 5:16 pm
Note this is NOT a file submission question. Please type your answers in the provided spaces. Shown below is a eukaryotic gene. Any spaces in the sequence are only to keep the letters (bases) lined up and do not reflect a space or break in the DNA. The +1 nucleotide pair is highlighted in yellow. Introns are shown in red. The cleavage site is in green. 5' - TCCATAT CGGTATGCGGCCTAGC CTTGTAGATGAGACCTGGCATGC - 3 ' 3' - AGGTATAGGCATACGCGGGATCG GAACATCT ACTCTGGACGGTACG - 5' Instructions: a) (4 pts) Copy \& paste the DNA sequence into the answer box, then label the template and coding DNA strands and highlight the promoter and terminator regions. Make it clear what you are labeling (use different colors) and highlight the whole sequence, not just the first basepair. b) (2 pts) Transcribe the gene, showing the initial pre-mRNA that has not undergone any editing. Make sure you start and end transcription in the right placel c) (4 pts) Now draw the mature mRNA that has been processed and is ready to leave the nucleus. Clearly label 3′ and 5′ ends.