Answer Happy

Note this is NOT a file submission question. Please type your answers in the provided spaces. Shown below is a eukaryotic gene. Any spaces in the sequence are only to keep the letters (bases) lined up and do not reflect a space or break in the DNA. The +1 nucleotide pair is highlighted in yellow. Introns are shown in red. The cleavage site is in green. 5' - TCCATAT CCGTATGCGGGCTAGC CTTGTAGATGAGACCTGGCATGC - 3 ! 3' - AGGTATAGGCATACGCCGGATCG GAACATCT ACTCTGGACCGTACG - 5' Instructions: a) (4 pts) Copy \& paste the DNA sequence into the answer box, then label the template and coding DNA strands and highlight the promoter and terminator regions. Make it clear what you are labeling (use different colors) and highlight the whole sequence, not just the first basepair. b) (2 pts) Transcribe the gene, showing the initial pre-mRNA that has not undergone any editing. Make sure you start and end transcription in the right place! c) (4 pts) Now draw the mature mRNA that has been processed and is ready to leave the nucleus. Clearly label 3′ and 5′ ends.
A) Fill in the correct genotype for each offspring phenotype. (Remember these offspring should be diploidl) B) Label each offspring as Parental, Single Crossover or Double Crossover. C) Which gene is in the middle? D) The recombination frequency ( r ) for the T-G gene pair is For gene pair E-T it is E) Based on the frequencies in part D, the total distance between the two outside genes is cM.