Page 1 of 1
As a student in a lab, you are provided DNA with the sequence that is shown below. Your mentor asks that you design DNA
Posted: Tue Jul 12, 2022 1:27 pm
by answerhappygod
- As A Student In A Lab You Are Provided Dna With The Sequence That Is Shown Below Your Mentor Asks That You Design Dna 1 (78.41 KiB) Viewed 24 times
As a student in a lab, you are provided DNA with the sequence that is shown below. Your mentor asks that you design DNA primers to amplify the bold and underlined region of the DNA by PCR. Provide the 10 nucleotide sequence of the primers that you would design and indicate the 5′ and 3' ends of each primer. (1) ATTGTATCCGCATTTGATGCTACCGTGGTTGAGTCAGCGTCGAGCACGCGGCACTTATTGCATGAGTAGAGTTGA CTAAGAGCCGTTAGATGCCTCGCTGTACTAATAGTTGTCGACAGATCGTCAAGATTAGAAAACGGTAGCAGCAT TATCGGAGGTTCTCTAACTAGTATGGATAGCCGTGTCTTCACTGTGCTGCGGCTACCCATCGCCTGAAAACCAGTT GGTGTTAAGCGATCCCCTGTCCAGGACGCCACACGTAGTGAAACAT What is the Tm and annealing temperature? (1)