Page 1 of 1
6. A segment of a polypeptide chain is Ser -Pro-Arg-Lys-Gln-Leu-Ala, encoded by the following DNA (the sequence aligns s
Posted: Tue Jul 12, 2022 1:22 pm
by answerhappygod
- 6 A Segment Of A Polypeptide Chain Is Ser Pro Arg Lys Gln Leu Ala Encoded By The Following Dna The Sequence Aligns S 1 (29.12 KiB) Viewed 56 times
6. A segment of a polypeptide chain is Ser -Pro-Arg-Lys-Gln-Leu-Ala, encoded by the following DNA (the sequence aligns so the first amino acid starts with the first nucleotide of one of the strands/ directions): GCGATCGACGAAGGAACCCCT CGCTAGCTGCTTCCTTGGGGA a) Which strand is the coding strand (top or bottomin? b) Which strand is a template stand (top or bottom)? c) Label each strand with polarity (5' or 3′) d) What is the mRNA sequence? (Write below and label the 5' and 3∘ ends of your mRNA): 7. For the polypeptide sequence (a very tiny protein, only 3 amino acids): Met-Trp-Phe. Write out are all of the possible inRNA strands that can encode this protein sequence. (Hint, there are six)