Page 1 of 1
6. A segment of a polypeptide chain is Ser-Pro-Arg-Lys-Gln-Leu-Ala, encoded by the following DNA (the sequence aligns so
Posted: Mon Jul 11, 2022 2:20 pm
by answerhappygod
- 6 A Segment Of A Polypeptide Chain Is Ser Pro Arg Lys Gln Leu Ala Encoded By The Following Dna The Sequence Aligns So 1 (29.99 KiB) Viewed 80 times
6. A segment of a polypeptide chain is Ser-Pro-Arg-Lys-Gln-Leu-Ala, encoded by the following DNA (the sequence aligns so the first amino acid starts with the first nucleotide of one of the strands/ directions): GCGATCGACGAAGGAACCCCT |||| ||||| CGCTAGCTGCTTCCTTGGGGA a) Which strand is the coding strand (top or bottom)? b) Which strand is a template stand (top or bottom)? c) Label each strand with polarity (5' or 3') d) What is the mRNA sequence? (Write below and label the 5' and 3' ends of your mRNA): 7. For the polypeptide sequence (a very tiny protein, only 3 amino acids): Met-Trp-Phe. Write out are all of the possible mRNA strands that can encode this protein sequence. (Hint, there are six)