1. A double stranded DNA has the following sequence: +1 5' 3' CCGCATGGCCGACGGTACCGGATGTACTTCCGTCTTTT GGCGTACCGGCTGCCATGG
Posted: Mon Jul 11, 2022 2:20 pm
1. A double stranded DNA has the following sequence: +1 5' 3' CCGCATGGCCGACGGTACCGGATGTACTTCCGTCTTTT GGCGTACCGGCTGCCATGGCCTACATGAAGGCAGAAAAAGTTTAGGCGTTA ||||||||||||||||||||| a) Transcribe the DNA fragment above (write the mRNA): Note: the +1 nt is underlined and labeled. O b) 5' UTR (label or highlight in green) c) 3' UTR (label or highlight in blue) d) Start Codon (label or highlight in yellow) Stop Codon (label or highlight in red) e) f) Bracket the open reading frame. g) Determine the complete amino acid sequence that would be translated from this mRNA h) Identify the C- and N-terminus of the newly synthesized polypeptide (add C- and N- to your polypeptide in g. above). 1st letter ||||||||| ATCCGCAAT 5' U UUU Phe UCU U UUC UUA UUG A CUA CUG AUU AUC AUA AUG Leu 3' coding strand CUU CCU CAU C CUC Leu ccc Pro CAC CAA CAG CCA CCG ACU ACC ACA Met ACG #13 a. Does this change where translation starts? b. Does this change the amino acid sequence of the protein? How? c. How is this insertion different from a 3-base insertion? GUU GOU G GUC Val GCC GUA GCA GUG GOG Second Letter C UAU Tyr UCC Ser UAC UCA UCO UAA UAG AAU The AAC AAA AAG GAU Ala GAC GAA GAG 2. The sequence (above) had a 4-base insertion (underlined below). 5' GGCGTACCGGCTGCCATGGCCTACATGAAGGCAGAAGAGAAAAGTTTAGGCGTA 3' A G UGU CY U UGC Stop UGA Stop A Stop UGG His COU COC Arg Gin CGA CGG Trp G AGA Lys AGG Asp GOU Glu Asn AGU Ser U letter AGC DUKO DURO DUO DUA Arg GGC GY GGA GOG 3rd