A sequence of DNA has the following nitrogen bases: Leading strand TACCGATGACCGGGCTTAATC 10. What nitrogen bases would b
Posted: Mon Jul 11, 2022 2:12 pm
A sequence of DNA has the following nitrogen bases: Leading strand TACCGATGACCGGGCTTAATC 10. What nitrogen bases would be found in the lagging strand of the DNA complimentary to the leading strand? Type the answer using capital letters with no spaces between them. (3.5 points) 11. What nitrogen bases would be found in the strand of mRNA made during transcription from this leading strand? (Remember to use complimentary base pairing.) Type the answer using capital letters with no spaces between them. (3.5 points) 12. How many codons would be found in the mRNA strand? Type answer as the number only. (1 point) 13. How many anticodons would this strand of mRNA need to form the protein? Type answer as the number only. (1 point) 14. How many amino acids would be found in the final protein coded for by this DNA? Type answer as the number only. (1 point)