13.1 The C Cb Marley & 211 15 ******* >> ala (alanine) (phenylalamine) arg (arginine) (proline) +1 HE R ********** 115 T
Posted: Sun Jul 10, 2022 4:19 pm
questions. All of the questions use the same non- template DNA sequence. non-template DNA strand leu (leucine) lys (lysine) met (methionine) Id I pro न ser tyr CTTTGACACAAGTTCACTTGCGGGTATAATCCCAGGGGTGGAGGACAT GATTAACGAAGAGGACTGGGCCAGAATGACACATTGATGTAG-3 1. What is the name and function of the sequence on the diagram above from the 5' end to +1 that are marked in bold? 5. How would a eukaryotic mRNA differ from the one you drew for question 4 including all forms that would be seen from transcription until translation? 6. What is the amino acid sequence coded for by this sequence? What is the "message"? Please use the single letter codes for each amino acid to decipher the "message". Hints: 1) The fimet amino acid is often deleted from the finished protein in prokaryotes, 2) The message should say something to you in English. You mus Sal
non-template DNA strand CTTTGACACAAGTTCACTTGCGGGTATAATCCCAGGGGTGGAGGACAT GATTAACGAAGAGGACTGGGCCAGAATGACACATTGATGTAG-3 1. What is the name and function of the sequence on the diagram above from the 5' end to +1 that are marked in bold? 5. How would a eukaryotic mRNA differ from the one you drew for question 4 including all forms that would be seen from transcription until translation? 6. What is the amino acid sequence coded for by this sequence? What is the "message"? Please use the single letter codes for each amino acid to decipher the "message". Hints: 1) The fmet amino acid is often deleted from the finished protein in prokaryotes, 2) The message should say something to you in English. You must show all your work to get any credit! 7. How many amino acids will be in your final protein BEFORE post-translational modifications? 8. How many ATP/GTP will be used to perform translocations in the production of this protein? 9. How many ATP/GTP will be used to perform peptidyl transferase reactions in the production of this protein? 10. How many ATP/GTP will be used to add amino acids to tRNAs in the production of this protein? 11. How many ATP/GTP will be used to initiate the production of this protein? 12. How many ATP/GTP will be used to terminate the production of this protein?
13.1 The C Cb Marley & 211 15 ******* >> ala (alanine) (phenylalamine) arg (arginine) (proline) +1 HE R ********** 115 T ************* Single letter codes for amino acids gly (glycine) G his (histidine) W !!! ************** ile (isoleucine) asn (asparagine) (serine) asp (aspartic acid) D (threonine) cys (cysteine) с (tryptophan) glu (glutamic acid) E (tyrosine) Y gln (glutamine) Q (valine) Please use the chart on the 1 page, and the following non- template prokaryote DNA sequence below to answer the following non-template DNA strand CTTTGACACAAGTTCACTTGCGGGTATAATCCCAGGGGTGGAGGACAT GATTAACGAAGAGGACTGGGCCAGAATGACACATTGATGTAG-3 1. What is the name and function of the sequence on the diagram above from the 5' end to +1 that are marked in bold? 5. How would a eukaryotic mRNA differ from the one you drew for question 4 including all forms that would be seen from transcription until translation? 6. What is the amino acid sequence coded for by this sequence? What is the "message"? Please use the single letter codes for each amino acid to decipher the "message". Hints: 1) The fmet amino acid is often deleted from the finished protein in prokaryotes, 2) The message should say something to you in English. You must show all your work to get any credit! 7. How many amino acids will be in your final protein BEFORE post-translational modifications? 8. How many ATP/GTP will be used to perform translocations in the production of this protein? 9. How many ATP/GTP will be used to perform peptidyl transferase reactions in the production of this protein? 10. How many ATP/GTP will be used to add amino acids to tRNAs in the production of this protein? 11. How many ATP/GTP will be used to initiate the production of this protein? 12. How many ATP/GTP will be used to terminate the production of this protein?