Page 1 of 1

quence landmarks T otion start aling sequence ling sequence ning sites Kho I) aling sequence or sequence in sequence 370

Posted: Sun Jul 10, 2022 4:18 pm
by answerhappygod
Quence Landmarks T Otion Start Aling Sequence Ling Sequence Ning Sites Kho I Aling Sequence Or Sequence In Sequence 370 1
Quence Landmarks T Otion Start Aling Sequence Ling Sequence Ning Sites Kho I Aling Sequence Or Sequence In Sequence 370 1 (48.84 KiB) Viewed 39 times
4.1. How many fragments will form if pET28a(+) is digested simultaneously with Sac and Bcll.4.2. Write down the base pairs that result at the 5' and 3' ends of the shortest fragment[314.3. Restriction enzymes often recognize palindromic sequences. What is a palindromic sequence? [2]4.4. Give three restriction enzymes found on the pET28(a+) multiple cloning site.[3]
4.1. How many fragments will form if pET28a(+) is digested simultaneously with Sac and Bcll.
4.2. Write down the base pairs that result at the 5' and 3' ends of the shortest fragment
[31
4.3. Restriction enzymes often recognize palindromic sequences. What is a palindromic sequence? [2]
4.4. Give three restriction enzymes found on the pET28(a+) multiple cloning site.
[3]
quence landmarks T otion start aling sequence ling sequence ning sites Kho I) aling sequence or sequence in sequence 370-386 369 270-287 207-239 158-203 140-157 26-72 773-1852 3286 3995-4807 4903-5358 or pET-28b(+) and pET-28c(+) e as pET-28a(+) (shown) with mg exceptions: pET-28b(+) is a mid; subtract 1bp from each site nH I at 198. pET-28c(+) is a mid; subtract 2bp from each site nH I at 198. Nco PET upstream primer #69214-3 Bo Pvulie125), Sgf (4426) Smal(4300) Cla 4117) Nru (4083) Eco57 13772) AlwN13640) BssS (397) 17 promoter primer 46348-3 17 promoter Dra Ill5127) (208-966) BspLU11 (224) tac operator 11 origin (4903-5358) ori (3286) Sap (108) Bst1107 (2995) Th11122963 Ap11021 His-Tag TATACCATOGGCAGCAGCCATCATCATCATCATCACAGCAGEGGOCT SCCGCOCOOCACCATA AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTOTGAGCOGATARCASTICCCCTETAGARSTARTTITO Bal PET-28a(+) (5369bp) NdeL Nhel thrombin His-Tag GGTOGGATCCGAATTOGAGETCOGTCGACAAGUTTGCGGCCGCACTEGAGCACCACC MetlySerSeriSHISHISHISHISHIsSerSerGlyLeValProrlesetarethelyi Bpu1102 (80) 17-Tag TACCATGACTOGTOGACAGCA MetlyArgySeriuPheGluteurgarginalaysGlyArgThrArgoProProProProProleurgeryCysEnd GOTOGGGATCCGAATTOGASCTCCGTCGACA&GETTOCOOCOOCAL TEGAGE GlyArgAspPreAsnSer SerSer ValasplysLeulleAlokiseutuishikishind Xho (158) Not (166) Eag (166) Hind (173) Sal (179) Sac (190) EcoR (192) BamH (196) Nhe (231) Nde (238) Nco (296) -Xoa 1935) Bgl (401) SgrA (442) Sph (508) rbs TTAGARUGAGA Eag! BamHI EcoRL Sacl Sall Hind Not Xhel ATGGOTCOCOGATCCGARTTCGAGCFCCGTCGACAAGETTO COCCOCACTCCASCACCACCACCACCACEACTGAGATCEGOCTOCTAACAAAGCCC DET-281-1 DET-286(+) ACCACTGAGATOCGGETGCTAACAAAGCCC DET-281-1 GlyArgileArgileArgAloProßer ThrerLeuArgProfiserer The The Thr The ThrThralulleArgLeuteuThrLysPro. 17 terminator GARACCARGETGAGTTGGETOETOCCACCOCTGAGEAATAACTAGCATAACCCCTTOOGGETOTARACOOGTETTGAG 17 terminator primer #8337-3 CCACCACEACTEAGATOCGOCTOCTARCARAGCCC PET-28a-c(+) cloning/expression region lacl (773-1852) -Bgl (2187) Fsp (2205) Psp5 (2230) Mlu (1123) Bel (1137) BstE (1304) Apa (1334) PshA I(1968) BasH (1534) EcoR V(1573) Hpa (1629)