Transcribe & translate these bacterial ORFs (open reading frame) from DNA sequence into mRNA / polypeptide. These are th
Posted: Tue Jul 05, 2022 7:41 am
Transcribe & translate these bacterial ORFs (open reading frame) from DNA sequence into mRNA / polypeptide. These are the non-template strands. 5' TCAATGGAACGCGCTACCCGGAGCTCTGGG CARATTTCATTGACACT 3' 5* GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAG Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to contain a very small gene. Transcription starts at the Transcription Start Site (TSS) after the promoter (shown in yellow), and proceeds in the direction of the arrow. Transcription stops at the end of the Transcription Terminator (shown in blue). TSS S-CTATRARCAGCCATGCATTATCTAGATAGTAGGCTCTGAGA 111 3-GATATTICO promoter Au ACCCCGGA 3* TOSCACT-3 100 TANTAGATCTATCATCCGAGACTCTTAAATAGASTGA-5 terminator a) which strand of DNA shown, the top or the bottom, is the template strand? b) What is the sequence of the mRNA produced from this gene? Label the 5 and 3 ends. Translate the primary structure of this mRNA. 5' GGAUGCAGGGUAGCGCGUUACAUUGAAAAUAU 3' c) What is the sequence of the protein produced from the mRNA in (b)? Label the N and C termini.